Gapdh molecular weight 36
WebThis constitutively expressed, homotetramer protein can be found in the nucleus and cytoplasm, and the monomer has a theoretical molecular weight of 36 kDa. Known as a … WebThe molecular weight of GAPDH is 36 kD. What is GAPDH? GAPDH stands for glyceraldehyde-3-phosphate dehydrogenase and is often referred to as a "housekeeping" protein. It is recognized as an important enzyme involved in metabolic pathways, aiding … Calculated molecular weight: 375 aa, 42 kDa: Observed molecular weight: 42 …
Gapdh molecular weight 36
Did you know?
WebAntigen Molecular Weight: 36.0 kDa Depositors Notes: GAPDH is an enzyme important to carbohydrate metabolism and is expressed in all cell types. Its ubiqutious expression is … WebFeb 1, 2012 · GAPDH; GAPDH protein is suitable for use as a molecular weight marker and protein standard for molecular biology applications, including western blotting and mass spectometry. KR EN. Applications Products Services Support. All …
WebApr 6, 2024 · A gel piece covering the expected molecular weight (37 kDa) was cut out and processed as described 44. In brief, trypsin digestion was done overnight at 37 °C. In brief, trypsin digestion was ... WebKey features and details Rabbit polyclonal to GAPDH Suitable for: WB Reacts with: Mouse, Human Isotype: IgG You may also be interested in Assay Glyceraldehyde 3 Phosphate Dehydrogenase Activity Assay Kit (Colorimetric) (ab204732) Primary HRP Anti-GAPDH antibody [mAbcam 9484] - Loading Control (ab9482) View more associated products …
WebList of primers used for quantitative real-time polymerase chain reaction Gene (ID) Primer sequence 5'-3' GAPDH F: AGGTCGGTGTGAACGGATTTG XM_017321385.1 R: … WebThe protein molecular weight was 36.1kD. The DNA sequence of GAPDH gene was obtained through PCR amplification with specific primers of cDNA 5' and 3' untranslated region. The analysis of DNA sequence indicated that GAPDH gene have 3 …
WebApr 10, 2024 · This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the …
WebApr 12, 2024 · Gapdh was used as the reference gene. ns, not ... 36, 58). Oral administration of mEVs was able to repair the leaky gut and alleviate NASH. ... (polyethylene glycol)-2000] (DSPE–PEG-2000, molecular weight 2000) were mixed in molar ratios of 1.85:1:0.15. Lipids were dissolved in chloroform-methanol [1:1 (v/v)] in a round-bottom … times table stuffWebGAPDH Synonym (s): Glyceraldehyde-3-phosphate Dehydrogenase from rabbit muscle, D-Glyceraldehyde 3-phosphate:NAD+ oxidoreductase (phosphorylating), GAPDH CAS No.: 9001-50-7 EC No.: 232-609-4 Match Criteria: Product Name, Keyword All Photos ( 6) Anti-GAPDH Synonym (s): Anti- GAPD, Anti- MGC88685, Anti-G3PD Match Criteria: Product … parfums de marly galloway ratingWebThis constitutively expressed, homotetramer protein can be found in the nucleus and cytoplasm, and the monomer has a theoretical molecular weight of 36 kDa. Known as a … parfums de marly cloneWebGAPDH is a ubiquitously expressed and has a molecular mass of 36 kD. Though differentially expressed from tissue to tissue, GAPDH is frequently used as a loading … times table super movers ks2WebJul 5, 2013 · Glyceraldehyde 3-phosphate dehydrogenase (abbreviated as GAPDH or, less commonly, as G3PDH) ( EC 1.2.1.12) is an enzyme of ~37 kDa that plays an important … parfums de marly greenley ราคาWebThis antibody is raised against full length GAPDH of human origin. It can recognize the 36 kDa GAPDH protein in most cells/tissues. In addition, a band below 36 kDa can always be detected as the isoform or spliced product of GAPDH … parfums de marly greenley storesWebMar 20, 2024 · GAPDH is a housekeeping gene and used as controls in both Western blot and qPCR. ... a splice variant with an extra exon with the molecular weight of 150 kDa is also expressed. Nuclear proteins - nuclear loading controls ... Human lamin B1 shares 95% identity with rodent homologs, and 36% identity with the fruit fly counterpart. Human … parfums de marly for men